Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ730433
Length 753 bp
Fasta Format > whvs8p19
tcctcgggatcctggcaggatacgccagtgtccgcgtctggaagacaatc aggtgtggagatcactcgggctgggtgggcgtttcgtggaggacagcctg cttcttccctggcatcgccttcctgatcctcaccacactcaacttcctgc tgtggggaagccagagcaccggcgccatccccttctcgctgtttgttgtg ctgatcctgctctggttctgcatctctgtgccgcttacactcgtcggcgg gttccttggtgccaaggcgccgcacatcgagtacccggtccgcacaaacc agatcccgcgcgagatccccgcccagaagtacccgtcctggctgctggtc ctcggcgccggcacgctgcccttcggcaccctgttcatcgagctcttctt catcatgtcaagcatctggatggggcgcgtgtactacgtcttcgggttcc tcttcatcgtgatgctgctcctggtcatcgtctgcgccgaggtctccctg gtcctgacctacatgcacctctgcgtggaggactggaagtggtggtggaa gtcattcttctcgtccgggtccgtggccatctacatcttcctctactcga tcaactacctggtgttcgacctcaagagcctgancgggccggtgtcggcg accctctacctcggctactcactcttcatggtcatcnccatcatgctggc caccggcacggtcgggttcatctcctcnttctgcttcntgcactatctct tct
Download
page-top