Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ730289
Length 794 bp
Fasta Format > whvs8g17
tcctcttactcctaaccagcgagtaacagccaatggcgttctccaagccc gtggcggctctcctcctcgccgtggcgctggcagcgactgccatgtccgc cgccggtcaggatccccaaaactgcaagccgagccgcaaggttacggtgc agaacctgtgcggcaaggacctttacctcggcatcgagccgctggccaac agcaagctgctctacagccctggccacctgctccgccacggcacccacgt gtcgtacgacgtgtgctcgtggacggggcgcgtgaaggtgcaggacgccg tggtgacggagttccacatcgggtacgacggcggggcgtggtaccaggtg agcaccgaccagtcgcacatgcccatccgtgtctccatcaccccccacgg ccaccccctgaaagaccactgccccaccgccggctgcaacagcggtggcc actgcttcgagcactccgtccccggcggcaagtgccacggcgtcgacgag atcaagatcgtctactacaacccctagatccagctgctgggtgtgtttaa taagtttgctgctcggtgatcttantcgtactgcagctgctagttantta tcatctgctccaaggagctattgtactgtcgtgtcncgttgtgtcngatt tgctgttcaattantanttgcngtggtgaatgcntggctananatgtttc atggccgtgcaatgaactgcatgtcntcanctctgtatccntcnttngtg tgttgtgttttctantttataaaatctnatttacaaaaaaaaaa
Download
page-top