Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ730237
Length 659 bp
Fasta Format > whvs8d10
ctcctcttactcctaaccagcgagtaacagccaatggcgttctccaagcc cgtggcggctctcctcctcgccgtggcgctggcagcgactgccatgtccg ccgccggtcaggatccccaaaactgcaagccgagccgcaaggttacggtg cagaacctgtgcggcaaggacctttacctcggcatcgagccgctggccaa cagcaagctgctctacagccctggccacctgctccgccacggcacccacg tgtcgtacgacgtgtgctcgtggacggggcgcgtgaaggtgcaggacgcc gtggtgacggagttccacatcgggtacgacggcggggcgtggtaccaggt gagcaccgaccagtcgcacatgcccatccgtgtctccatcaccccccacg gccaccccctgaaagaccactgccccaccgccggctgcaacagcggtggc cactgcttcgagcactccgtccccggcggcaagtgccacggcgtcgacga gatcaagatcgtctactacaacccctagatccagctgctgggtgtgttta ataagtttgctgctcggtgatcttagtcgtactgcagctgctagttagtt atcatctgctccaaggagctattgtactgtcntgtcgcgttgtgtcggat ttgctgttc
Download
page-top