Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ729931
Length 565 bp
Fasta Format > whvs7b13
gtcacagcagcatccgtcgccactaattaattgcagctgtagcaccgccc gcccgctccgatggagcttacaagccaccagcgaggagagtcgaggcgcg cacgtgggtgggtctgcgcgcgccgtccgtcgtcgtcgtcctcctagatc caacagcctttgtccctgctcggagccgtgcgccgggcggagggacgcgc gacgatggccaccggccgtgggctcccgctcctcctcgtcctcgccgccc tcctggtcgggctcgcctccgcctcccccttcatctccgacggcgtgttc caggcgggcgccggatctactacggggaggaccttgctgcaggccaagag ggattgtcctgtgaacttcgagttccaaaactacaccgtcatcacaagca ggtgcaaagggccaaaatatcctcctaaagactgctgtgattctttcaag gaatttgcatgcccatttaataactacatcaatgatgaaagcaatgactg tgcatccacaatgttcanctacatcaacctctatggcaagtacccaccag gcctgtttgcccacg
Download
page-top