Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ729298
Length 475 bp
Fasta Format > whvs4i21
agctgccggccgacgacaagaagaagatcgaggatgccatcgatgctgcc atccaatggctggacacgaaccagctcgctgaggcggatgagttcgagga caagatgaaggagctggaggccctgtgcaaccccatcatcgccaagatgt accagggtgctggtgccgacatggagggcggcatggacgacgacacccca gctgcatccggcggccctggccccaagatcgaggaggtcgactaaacagt cagttgttctgttgcagaggcggcgaagcctgctgcttattataccgtgt ctgtgttatctgagacttgaggttgtggtggttattgttttgcttccgag tggtcggagttattccgtgcgagttgcaacattcgtggtagtggatcaag ggttatgatgtctcacgtctaagtatattattagtttgttggtatttcta ctgtacctttatattaaaaaaaaaa
Download
page-top