Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ729228
Length 799 bp
Fasta Format > whvs4e13
ggccttctccaagaacctcaagcttggcatccacgaggactcccagaaca ggaccaagattgctgagcttctgaggtaccactccaccaagagtggtgat gagctgacgagcctcaaggactatgtgaccaggatgaaggagggacagaa cgagatctactacatcactggtgagagcaagaaggctgtggagaactctc ccttccttgagaagctgaagaagaagggctatgaggtcatctacatggtt gacgccattgatgagtatgccattggtcagctcaaggagtttgagggcaa gaagcttgtctctgccaccaaggagggtctgaagcttgatgagagcgagg acgagaagaagaagcaggaggagctcaaggagaagtttgaggggctgtgc aaggtcatcaaggaggtgctgggcgacaaggttgagaaggttatcgtctc tgaccgtgtggtggactccccttgctgtctggtgactggcgaatatgggt ggaccgccaacatggagaggatcatgaaggcccaggccttaagggactcg agcatggctggctacatgtcgagcaagaagaccatggagatcaaccctga gaacgccatcatggacgagctccgtaagcgtgccgatgccgacaagaacg acaagtctgtcaaggacctcgtgatgctgctcttcnagacctccctgctc acctccggcttcancctggaggaccccaacaccttcggcaccangatcca ccgcatgctcaagcttggcctgancattgatgangatgacnaggcgcca
Download
page-top