Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728870
Length 806 bp
Fasta Format > whvs2o15
cgatcgttgacagcggcattgggatgaccaagtccgacctcgtcaacaac ctcgggaccatcgccaggtcggggaccaaggagttcatggaggccctcgc cgccggcgccgacgtgtccatgattgggcagttcggtgtcggtttctact ccgcctacctcgtcgccgagagggttgtcgtcaccaccaagcacaacgac gacgagcagtacgtgtgggagtcccaggccggtggctccttcaccgtcac tcgtgatacgtctggggagcagctcggcaggggtaccaagatggtcctct acctcaaggacgaccagatggaataccttgaggagcgccgcatcaaggat ctagttaagaagcactctgagtttatcagctaccccatctccctgtggac tgagaagaccaccgagaaggaaatttctgatgatgaagatgaggaggaga agaaggatactgaggagggcaaggttgaggatgttgatgaggagaaggaa gagaaggaaaagaanaaaaagaagatcaaggaagtctctcacgagtggaa cttggtcaacaagcanaagccgatctggatgaggaagccagaggagatca acaaggaagagtacgctgctttctacaagagcttgaccaatgactgggag gagcatttggctgtcaagcacttctctgttgagggtcancttgagttcaa ggctgtcctgtttgtgcccaananggcccccttcnacctcttcnacaaca anaanaangccaacaacatcaanctgtacntgcnccntgtcttcatcatg gataac
Download
page-top