Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728777
Length 708 bp
Fasta Format > whvs2j10
gactgccatgtccgccgccggtcaggatccccaaaactgcaagccgagcc gcaaggttacggtgcagaacctgtgcggcaaggacctttacctcggcatc gagccgctggccaacagcaagctgctctacagccctggccacctgctccg ccacggcacccacgtgtcgtacgacgtgtgctcgtggacggggcgcgtga aggtgcaggacgccgtggtgacggagttccacatcgggtacgacggcggg gcgtggtaccaggtgagcaccgaccagtcgcacatgcccatccgtgtctc catcaccccccacggccaccccctgaaagaccactgccccaccgccggct gcaacagcggtggccactgcttcgagcactccgtccccggcggcaagtgc cacggcgtcgacgagatcaagatcgtctactacaacccctagatccagct gctgggtgtgtttaataagtttgctgctcggtgatcttagtcgtactgca gctgctanttagttatcatctgctccaaggagctattgtactgtcgtgtc gcgttgtgtcngatttgctgttcaattantanttgcggtggtgaatgcnt ggctananatgtttcatggccntgcaatgaactgcatgtcntcanctctg tatccntcnttggtgtgttgtgttttctantttataaatctnatttacaa aaaaaaaa
Download
page-top