Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728630
Length 744 bp
Fasta Format > whvs2a17
agttgcaacctctccctctcggcgaatttggggtttctgaggcgcgcgag gtaaaccaaggttggtgctcatggctcgtactaagcagactgctcgtaag tccactggaggaaaggctccaaggaagcagttggccaccaaggctgcccg taagtctgctcccaccactggaggagtgaagaagcctcaccgttaccgcc ctggaactgttgctcttcgtgagatccgcaagtaccagaagagcactgag ctgctcataaggaagcttcctttccagaggcttgttagggagattgccca ggacttcaagactgacctccgcttccagagccatgcggtgctggcccttc aggaggctgcagaggcctacttggtgggtctcttcgaggacaccaacctg tgcgccatccatgccaagcgcgtgaccatcatgcccaaggacattcagct ggctaggaggatccgtggcgagagggcttaaggtgcttgctttgcctgtg ggaatggctctggtgggcatctgcgtctgcttttgctgctgaacacttgt catgtgtcgtgaactactaatactggtcgtgtgtagtaatatgtcagtag cgtactctgtgcaatactatgttcgtggagctggatcatttgttcgttgg tcgtcctaaatcatccacctggttggtgcctatctgaancttgcatttta tgtctgaaaattantgattgtgtgaaccattattaaaaaaaaaa
Download
page-top