Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728190
Length 823 bp
Fasta Format > whvs1f19
gagctcagcagcgtcgaggatctgtggaaggactttgcctcgtcggacaa agcaaggaaggtggttgagctgaaggctttcaacaagtttgaaaatactt ctgatgctctttcagccgcaactttgctgattgatagcaagcccagcaag ggtctgcgcaagttcctgcagaagcactgtgatggtgaaacattggctgt tgctgattccaaacttgggaatgccatcaaagaaaagctgcaaattgatt gccttcacaactctgctgttatggaactgatgagagggctgaggaaccag ctcactgaacttatgtctggactagctgagcatgatctaggtccaatgag cctaggattgtcccacagcttgtctaggtataaactcaagttcagccctg aaaaggttgatactatgatcattcaggccattggcttgttggatgatctt gacaaggagcttaacacttacgctatgagggtccgtgaatggtacggttg gcactttccggagctcacaaaaattgttgcagataacatccattatgcga aagctgtgaagatgatgggcaatcgtgttaatgcagttaaccttgacttc tctgagatacttccagaagaagtggaagcagagctgaaggaggcagctgt aatttccatgggaacagaagtcaatgatcttgacctctcaaacattangg aactgtgtgatcaagtcctggctctttctgagtacagagcccanctctat gactatctaaaaagtanaatgaataccattgctcccaacttgactgcact tgttggtgaacttgttggcgctc
Download
page-top