Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728188
Length 818 bp
Fasta Format > whvs1f17
ggcgagcttaggaatgatgctaacacagatgttatggaggacgactcata ccgcgatcagggttttacacgtccaaaggttcttttcttgttacctctca aaagcattgcacgacgcattgtgaagagattaatccaattatctccgctg acacaaaaggataattctatgggacaattcaagaaagagtttggcgaatc agatgatgaactggaggagccaaatagttcaaaaccaacagactttaacc ttctgtttgctggggatgttgaagatcactttctttttggaataaaattt acaaagaaatctgttaagttatacagcaatttctacgcttctgatatcat agttgcatctcctttagcgcttaaacttaaaattgatggaggtgaagtta ccaagaaaaagggacgtcccaaggaaaacgattctgatttcctgtcatca attgaaatagtggttgttgattacgcagatgtgatatctatgcagaattg gtcgcatctgcatgctgttcttgaacaactaaatcatttgccatcaaaag agcatgtaaccaatgtgatgcggatcaggccatggtacctggatgagcaa gcacggtactatcggcagacaataatattaagttcgtatcttacgccaga gatgaatgctttgttcaacggatcatgtctaaattacgaggggaaggtta agctggcgactgagtttacaggtgttcttcccaaaatacagcttgaaata cggcaggtgtatgaacgatttgatgcatcttctattggtgaacttgatga tgcccgctttgaatattt
Download
page-top