Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728187
Length 446 bp
Fasta Format > whvs1f16
gcgatctgctgctcccgagcgcagccacctcgtccccgaccccgagctcc ccctgtnantcttttccccgtcatctccgtgattcccttcttctctattt cacccgtttactcacatctccctctatctctcttgctttctattacaggg aggccgccatggacgcctaggtcctccactccaagcctccgacccacacc ccggcggccctgccgacgtcgacgcctaggaagaccaccatgctcgctgc aggagcttcgagccgaccccgcagcatgtagacctccgccgcccgtccgt cgtggggaatcaccagatccggccggtatccgacctgcctcgccatcctt cgcccgttcccggcgtatccccgacgccaggagctcaggcgagcgccgcc acaagactntgcctcatctgntccggagcncgccatggaggcaatg
Download
page-top