Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728186
Length 843 bp
Fasta Format > whvs1f15
gtccggctcgccctaccgcctggccaagatcagtgatatggtagcagttg cacgaatactcaaggctacacttataatcccagaacttgataagaaatcg ttttggctcgacaaaagcaacttttcggatgtcttcgacgaagaacactt tatacgttatttggcaaacgatgtgataattgagaaaaagttgccaaagg aattggtgaaagcaccaaaatctgttaggtacttcaagagttggtctgga gtagattattatcaggatgagatttctccactatgggagcaccgtcaggt tattcgagctgctaaatcggattctcgccttgcaaacaacttcctccctc ctgatattcaaaaacttcgctgccggacctttttccaggcacttagattt gctcccccaatcgaagctttaggcaatcttttggtggagaggatgaaagc atttggaccatatattgctttgcatttacgctatgagaaggatatgcttg cttttagtgggtgtacgtatggtctgtcagagaccgaatcagaggagctt gcaatgatcagaggaaacacaacctactggaaggtgaaagacattgatcc attagaacaaagatcacatggtcattgtcccctgacgccaaaggaggttg gaatgtttctttctgccctaggatatccatcaagcaccccagtttacata gctgcaggggagatatatggaggtgaatctcatatggtcgatttgcaatc ccgattcccaattctgatgaacaaggagaaactggcctctgctgaagaac tgcgaccgttcagcccaatatgcttctcaaatggcagctttgg
Download
page-top