Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728182
Length 756 bp
Fasta Format > whvs1f07
gtcggcactgccgctgcgacttcttggcgagcgctcggatcaggtttcac tgcgcgaagaagccgccggatcttctccgaaggttggccgagatcccgag tgcaaatctgaaccccgtgcgtctccgagtctcgggggattccatgcgag attttgattttggggatctttcttgttggataacagttcagcggccgtcc gatctgcgctctctacaccagtgattgcactttttgctgttgtaccctgc tgcggttggttactcagggtttgcatcaagtccaaagatgactttgcgca gcatagttcgcgatttaagggagagctttggaaacctgtcaaggcggaat ttcgaggcgaaaatctcaagcgtcccaagcctttcgggccatcacagagg gaaatcgcttgaatctgcaagtgatctgcaggatagtcttgtcacaaacc tgcaaggcaattgggctagccttcctcctgaattacttcgggatgtgatg aaaaggctggaggaagacgacagcaattggccatcccgcaaggatgttgt tgcttgcgcttctgtctgtacaacttggagagagatgtgcaaggatatag tgaggaacccanaattctgtggaaagctcacctttcctgtgtcccttaag cancccggatctcgagatggattgatccaatgtttcatcaaaagggacaa gtcaaagctaacttatcgtctctacctgtcccttacttctgctgtgcttg atgaca
Download
page-top