Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728180
Length 305 bp
Fasta Format > whvs1f04
agagagagagagagagagagagagagagagagagagagagagagagntag agagagagagagagagagagagagagagagagagagagagagagagagng ngggggnntcttctctctctcnngngnnncncccctctctntnngngngg ngcgcncnnnngnnnntntgtntntntcnctcnntttntnngcgnggggg ggngnncnntctntntcnncncncnnnnccccctctctctctntctcncn cncnccnnncacnctctcnncgcgcgcgcnctctctctctctctctctct ctcnc
Download
page-top