Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728174
Length 739 bp
Fasta Format > whvs1e21
caagtgcactcgtcggcggcgcggcgcggcggctgcctcctctgctcgtc cgatcgagctcgcttcgtcgggtgagcgcggtcgattcgggagctgaagg gagcatgagtactgccaacggcacacggcgtgcctcaagaaggcaatcac aagatgctgataaggtcgtcgtgaacttggtctcaacccccccagcggcg ggcagccgtcgtggagtatcgacctctaacgctggcgcgcgcacctcacc cattgacgtggaagccctcgaggatgaagtgcaggtcgtatcagcttcac aagtgcctcctcagaggaggaaccggagacctaggaggcagcctgtgaca gtagttgatctcgatgtacatgctacccggcaaggagtttctcatgatga taatgcaacagtgctttctcctaacacaaggaacaaacgcccaagagttg ctcctgtaatagacatctctccagaaacaggagaagggtccagcttacag tcaaaaaatgcggggaaaactagcaaagagcatctgaatgtggctccaaa ggaacccatcttcacctgcccggtgtgttggaacaagttggatgagccag ccacaacaatgtgcggccacatcttctgcacaaactgcataaagcaagcc atccagttccagaagaaatgtcctacctgccggaagcacctgaagatgaa caatttccatcgcatttaccttcctaacacctcccgtta
Download
page-top