Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728173
Length 613 bp
Fasta Format > whvs1e20
agtccctcctggaggcgcttcctggtgacaatgttggcttcaacgtgaag aacgttgctgttaaggatctgaagcgtgggtttgttgcatccaactccaa ggatgaccctgccaaggaggcagccaacttcacctcccaggtcatcatca tgaaccaccctggtcagatcggcaacggctacgccccagtgctggactgc cacacctcccacattgctgtgaagtttgctgagctggtgactaagatcga caggcgatctggtaaggagctggaggcgctgcccaagttcctgaagaacg gtgacgctggtatcgtgaagatgattcccaccaagcccatggttgtggag accttcgccacctaccctcctcttggccgcttcgctgtgcgtgacatgag acaaacggttgctgttggtgtcatcaagggcgtggagaagaaggacccca ccggcgccaaggttaccaaggctgccatcaagaagaaataggcatctatc tagcagaaggtttttgttcatggtcattgcttttgttgctgcagactctt atcccgggcgagcaatgatcctgtctgtcgtttaattactgtatttctat tccaaaaaaaaaa
Download
page-top