Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728170
Length 802 bp
Fasta Format > whvs1e17
ccctctaatcccccaacccatccgccgccgccggcggcgaccaccaccgg agctctccaatccctaccgccagccgcccgcaccggcctcgatctctcct cagaggcaatctcttgcagaacctatggacagttctaaatctccccaacc attgaagaagagccgtactagtttgtctggtacggatggccaccaatttg agaatgacgagcttccgtctgaaactgcatcagataaaacgcctggtttg aagtttgaaacagtagataaagcgcaagatgaatttggagaagacagttc cccattgcagcaatcagctgcttccaacgtgtcataccgtggatcgccat gtattggggcattcactatccaatgtgctaggtgcttcaaatggagactt attccaacgaaagagaagtatgaagaaatacgcgagcatattatacagga accttttgactgcgaaagagcccgtgaatggaaacctgatgtaacatgcg atgatcaagaagatatttctcaggatggaagcagactctgggctatcgac aaacccaatattgcacagcctcctgctggatgggaaaggcagattagaat aagaggtgaaggaggcaccaaatttgctgatgtgtactacacttctccta ctgcgaggaaactgaggtcactggttgaagttgatcggtacctccaagaa aatccagagtatggagcgcagggtgtaacattagctcagttttccttcca gattcctagacctctgcggcagaactatgtcaaaaagcgccctaagaacg ca
Download
page-top