Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728169
Length 680 bp
Fasta Format > whvs1e15
gttcccgggccccgtcgttcaacgttcaccacaaactacaacgtcgccgt caacgtcctcaacagcctcgacgagccgctcctcatcacctgggacggca tccagcagcggaagaactgctggcaggacggcgtgctgggcaccaactgc cccatcccgcccggctggaactggacctacaacttccaggtcaaggacca gatcggcagcttcttctacttcccgccgctctccatgcagcgcgccgccg gcggcttcggcggcatcaccgtcaacaaccgtgccgtcatctccgtcccc ttcgacacccctgacggcgacatcaggctcttcatcggagactggtacaa gaagaaccacacggacctgaggaagatgctcgatgatgggaaggacctcg ggatgccggacggtgttttgatgaacggcaagggcccgtaccggtacaat gactccctcgtcccggatggcatcgagtacgagaccatcgatgttgagcc aggcaaaacgtaccgcttccgagtccacaacgtgggcatctccaccagct tgaacctgaggatccagggacacaacatggccatggtggagacggagggc tcctacacgatgaancagaatttcaccaacctcnacatccacgtggggca gtcctactcctttctggtcaccatggacca
Download
page-top