Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728165
Length 674 bp
Fasta Format > whvs1e07
cgccgcgtccatcatcaccagcagcaccacgccaccccgatcgatcccat gattgacgccatgttttcttgcgcgatcaggtccgttgaggagcgatcgg gcggcgtgcacaagcggtcgtcgcccgacaaggcgccgcaccacaagccc cccgccgcggagcatcacatggattccaagaacgcccaccaccaccacaa caacaaccacgactcgcagctggcgtccgccgccaacggcaacggcacgg gcgccggcgagaagctgggcggggagcggctggagcttccccggatctac atctcgctgtcccgcaaggagaaggaggacgacttcctggtgatgaaggg caccaagctgccccagaggcccaagaagcgggccaagaacgtggacaagt cgctccaattcgtgtttccagggatgtggctctcggatttgaccaagggc cggtatgaggtgcgagagaagaaatgtgtcaagaagaggcgaagagggct gaaagggatggagagcatggacagcgactcggagtgaagagcgcagagga aaggagacgagacggccaaggaagaagatggggatgtcatgtgtggancg aggcgtgttanganaaaacaaaaccggtananagagcttancccaaagga atggacncnacatttgtaaatgga
Download
page-top