Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728163
Length 616 bp
Fasta Format > whvs1e05
cagcagcggcagcggcatccatggacccctaaggcggagaagaagccggt ggcggagaaggccgagaagaccacgacggcnaagaanaccaaggccgaga agaggccaccggcgtccaaggagggcggcgagaagaagggcaagaagaag tccaagaagagcgtggagacgtacaagatctacatcttcaaggtgctgaa gcaggtgcaccccgacatcggcatctcctccaaggccatgtccatcatga actccttcatcancgacatcttcgagaagctcgccggcgagtccgccaag ctggccaggtacaacaagaancccaccatcacgtcccgggagatccagac ctccgtccgcctcgtcctccccggcgagctcgccaagcacgccgtctccg agggcaccaaggcagtcaccaagttcacctcctcttanatagcctgctct tgtgtcttctctgaatgtgttgacatctcgtgggtgtttgatgaatccac tgtgctctgtanttanatgttcanaacgcancatcttgtaatttgtgagg gcacaaatgtttcangatatggtggaaatantaatggtgttgctttgatc tgtttcaaaaaaaaaa
Download
page-top