Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728162
Length 833 bp
Fasta Format > whvs1e04
gagctcgagctgaagcttaagatggccaaggttaacgccggcgccgccct gttgtctctgtgcctgttgctggcgtattctgccgggcaatcggcggccg cctacgtggacgtggagggcaccgtaaggaaagaagtagagaatgccatc aagggcaaccccggcatcggcgcggccctcgtccggctggtgttccacga ctgctgggttaatggttgcgatggatcggtgctcttggacaagacgccat ccggtggcaacaccgagaagaaggcgatcaacaacatcggcctggacggc ttcaacctgatcgacaccatcaagtacaaactgggcaacagcgtctcgtg cgctgacattgtcgtcttcgccgcgcgtgacgcggccagatacctgagcg gcggcaaaatcgcctactccgttccctcagggcgcaaggacggcattgtc tcgtcggatgctaccgcagacgccatcctcccgcaatccacctttgagtt ccagcagctcaaggacaacttcgccaacaagggcttcacccaggaggagc tcgtcatcctctccggcgcgcactccatcggcgtctcccacctctcgtct ttccaggaccgcctcaacgattcaaccgcgaccccgatcgacnacagcta caagcangcgctcgttaaggacgtcnaggatcanaanaanagccaaaata cntcngatccnatcnanaanaacaacatccncnacatgancttgaanttc canaacnactccngctacnacaccacnggggtgaacaccncnncnaangg cnccctggacaacanctactacccacnccaacc
Download
page-top