Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728159
Length 454 bp
Fasta Format > whvs1d23
cctccctggnatcaaggtggacaagggtaccattgagcttgctggaacca acggtganaccaccaccnagggctttgatgaccttggcaagcgctgcgcc aagtactatgaggctggtgcccgcttcgccaagtggcgtgcagtcctcaa gatcggcgccaccgagccatcgcanctctccatcgaccanaacgctcang gtctggctcgctatgccatcatctgccaggagaatggtctggtgcccatt gtggagcctgagatccttgttgatggacctcatgacattgactgctgtgc ttacgtcaccgagatcgtccttgctgcctgctataaggccctcaacgacc agcatgtcctcctcgagggcactctcctgaagcccaacatggtcacccct ggttctgactccaanaangtggcccctgaggtgattgctgantacaccgt ccgc
Download
page-top