Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728150
Length 675 bp
Fasta Format > whvs1d12
cgctcgcctcgagattcgcgcggccgtgtctgcctctgggtccgcgcttc cgttgtctagcgtcctgagctgagctagatctctcagctcgctctttgcc ggcgctttgggcttagatctggctggggcgagtaggcggaggccgatcgc ggattcgtgacgagggaggggagccatggagctgggggcggccgggatgc ggcggtcggcgtcgcacaactcgctgtccgggtccgatgacttcgacctc acacacctgctcaacaagccgcggatcaacgtcgagcgccagcgctcctt cgatgaccgttcgctcagcgacgtctcctactccggtggccacgccagag gaggcggaggcttcgacggcatgtactcccccggcggcggtctacgctct ctggtcggcacgccggcctcctcggcgctccactctttcgagccccaccc catagtgggcgacgcctgggaggccctccgccgctccctcntctttttcc gcggccanccgcttggtaccatcnccnctttcnaccatgcatccnangaa ntcctaaactatgatcangtctttgtgananatttcntgcccancnccat ggcntttctnatnaatgntganccnnanattgtnaanaanttcctgctca anancnttttnctncannnntnnna
Download
page-top