Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728146
Length 762 bp
Fasta Format > whvs1d06
cactcctggatggaagcgaagcaccccggctcaagatatgtgatttcggt tactccaagtcctctgtgttgcattctcaaccaaaatcaaccgtcggtac tcctgcctacattgcccccgaggtcctttctagaagggaatatgatggaa aggtcgctgatgtctggtcgtgtggagtaaccctatatgtgatgcttgtc ggcgcttatccttttgaggacccagacgaaccaaagaatttccgcaagac aattactcggatactcagcgtacaatatgcagtacccgattacgtccgga tttcaatggagtgcaggcatttgctgtcccggattttcgtggcaaaccct gagcaacgaataaccatccaagagatcaagaaccacccatggttcctcaa gaatctgccgatcgagatgaccgacgagtaccagatgagcctgcatatgg tcggcgtcaacgctcccccgcagaccctggaggaggtcatggccatcatc caggaggcacggataccgggcgacggatccaagtttgccgggcagctgtc ggttcccgggctagggagcatggagctcgatgacatagacgacgtcgacg cggacgtcgaggacagcggcgactttgtgtgcgcgttgtgacgggcaggt gtggttccccttggtggtgtggctttgtgtttgtaatgtgttcatccttc tggtgtgtcntctgttgcananggttgcngngtgctnntgnatnattaca tgtgnttctgna
Download
page-top