Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728143
Length 816 bp
Fasta Format > whvs1d02
agtttagatagctcaaacacttctcacaggttgattgcatccgactctaa tgcaactctctgtcactcggacaaggatcatgcgcttataacaccagaga ctaatgccacaataatgcttgagaaaggcaacagccagctccgtactgtg tcgagtcagcagtttaaccaaaatgtttcacggacaccaagtgtgtcaca ggaagcatcaagcagtgtctttgttcccatagacccttctagtgttcaaa atccacacgggcgttttccttcagccagtgcccatcatggaaatttaact ttcaatcagcaaccaaacaatggatggtttcaaagaaaacctgaatctca atctactgtagaggttagagccagggggcatccatctgtcgcagcacaac atgcccatccatctgtcgcaccacaacatgcccatccatctgtctcacca caacatgcccatccatctgttgcaccacaacatgcccatccatctgccgt agcacaacatgcccatccacccgccatagcacaccctgctctggaaatgc acaacaggaatggaggtccacagaggggtcctcgcatagcaaatgtcgtg catcgattcaaatgctctgttgaacctctggaaattggtactgtgttatc agggagaatgtggtcttcaggccaagcaatcttccccaaaggatttagga gcagagtaaaatactggagcatcgtggatccaattcaaatggcatactac ttttccgaaatattagacgctgggttgcaaggacctctatttatggttac tgtagagaactgccca
Download
page-top