Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728142
Length 354 bp
Fasta Format > whvs1c24
tggtgtccggctccggcgtgtgcgccaagcgcgtggtggtggacgcccgc caccacatgctcggccgcctggcctcgatcgtcgccaaggagctgctcaa cgggcagcgcgtggtggtggtccgctgcgaggagatctgcatgtccggcg gcctcgtccgccanaagatgaagtacctccgcttcctccgcaagcggatg aacaccaagccctcccacggccccatccacttccgcgccccggccaagat cctctggcgcaccatccgcggtatgattccgcacaanaccgcnaggggcn angncncnctcnccangntcaangcntacnanggcntcncnccnnnntan nana
Download
page-top