Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728139
Length 218 bp
Fasta Format > whvs1c20
gcgatcttctttctcttcgagttcttggagcttgcgaccgacagggnaca gggatggcgaccgccgggaaggtgatcaagtgcaaagcggcggtggcatg ggaggccgggaagccgctgtcgatcgaggaggtggaggtggcgccgccgc aggccatggaggtgcgcgtcaagatcctctacaccgccctctgccncacc gacgtctacttctgngaa
Download
page-top