Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728134
Length 605 bp
Fasta Format > whvs1c12
ggctctcctcctcgccgtggcgctggcagcgactgccatgtccgccgccg gtcaggatccccaaaactgcaagccgagccgcaaggttacggtgcagaac ctgtgcggcaaggacctttacctcggcatcgagccgctggccaacagcaa gctgctctacagccctggccacctgctccgccacggcacccacgtgtcgt acgacgtgtgctcgtggacggggcgcgtgaaggtgcaggacgccgtggtg acggagttccacatcgggtacgacggcggggcgtggtaccaggtgagcac cgaccagtcgcacatgcccatccgtgtctccatcaccccccacggccacc ccctgaaagaccactgccccaccgccggctgcaacagcggtggccactgc ttcgagcactccgtccccggcggcaagtgccacggcgtcgacgagatcaa gatcgtctactacaacccctagatccagctgctgggtgtgtttaataagt ttgctgctcggtgatcttagtcgtactgcagctgctagttagttatcatc tgctccaaggagctattgtactgtcgtgtcgcgttgtgtcggatttgctg ttcaa
Download
page-top