Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728125
Length 579 bp
Fasta Format > whvs1b24
gatcgacggccgccccaccctcatcgctcttccccncgtngcgccggcag atctacgcgggcggcgaccctattcgtcggcggctcacctttcgcgacgc tcctctctagccatgtctacaatgaaggggcagacaaggagggagaggcc tagaactcgtcctcatggcctcacgcaacagaagaggcaggaaataaagg aagcgtttgatctttttgacaccgataactcaggaaccatcgatgccaag gagctgaatgttgcgatgagagccttgggatttgagatgacagaagagca aatcaatcagatgattgctgatgttgacaaagatggcagtggatcgatag attatgaggagtttgagcacatgatgactgccaagattggggagagggat actaaagaagagcttacaaaagcgttccgcatcattgaccaagataaaaa tgggaagatttcagatgttgatattcagcgtattgccaaggagttgggtg aaaacttcactctccaanagatccnagaaatggttcaagaggcanatcaa aatggtgatggtganatanattttgnnga
Download
page-top