Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728124
Length 769 bp
Fasta Format > whvs1b23
ctccgcggccgcgcggagacggagcaccgccggacgcctccctgctccgg tgctccctgtgtagggttgcgcttcgctcgctttactaccaggctaccta tcaccatctgctcaagtgaatgcactggacactggaaacttcttcttgcc aatggccaatacgtccaacaagcgcatgggaccaacagggttttcggata tcacaagtgacaggatcagcagcctccctgatgagattctccaccatatc ctgtctctcatgactgcacgagaagcagtgcagacatgcgtgctatccac gaggtggcgcggcgtttggatgtctttgcggtgcattgaagttgaggcac aggaattcaccaacatggagagatttgtgatgttcatggacaacctacta ctgcgccgtggtttggtacctctagatagcttttccctcatgggctggag cgatgatttttcccttaaccatcccagagctaacctgtgggtctgccacg cccttaggagcaatgtccgtgtgcttcagatcttcagccgtaaattattt aatcttgagtactctcccttcatttcgtcgcatctgaaaatactcaatct ccgtgatgtttccatcgctgccctcttcattgagaagctcttttctggct gtccgcanctggaanaactatcattggtanactgtcgtgttcctgccacc aagttctcctctangaccctgaanaaattaacatttatcgcacatacccc ctatggtgctgatgatgtc
Download
page-top