Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728122
Length 807 bp
Fasta Format > whvs1b21
gcgagcttaggaatgatgctaacacagatgttatggaggacgactcatac cgcgatcagggttttacacgtccaaaggttcttttcttgttacctctcaa aagcattgcacgacgcattgtgaagagattaatccaattatctccgctga cacaaaaggataattctatgggacaattcaagaaagagtttggcgaatca gatgatgaactggaggagccaaatagttcaaaaccaacagactttaacct tctgtttgctggggatgttgaagatcactttctttttggaataaaattta caaagaaatctgttaagttatacagcaatttctacgcttctgatatcata gttgcatctcctttagcgcttaaacttaaaattgatggaggtgaagttac caagaaaaagggacgtcccaaggaaaacgattctgatttcctgtcatcaa ttgaaatagtggttgttgattacgcagatgtgatatctatgcagaattgg tcgcatctgcatgctgttcttgaacaactaaatcatttgccatcaaaaga gcatgtaaccaatgtgatgcggatcaggccatggtacctggatgagcaag cacggtactatcggcagacaataatattaagttcgtatcttacgccanag atgaatgctttgttcaacggatcatgtctaaattacnangggaaggttaa nctggcgactgantttacaggngttcttcccnnnatacnncttganatac ngcangngnntgancnatnnnatgcntcttcnattgnngaacttgntnat gcccnct
Download
page-top