Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728121
Length 713 bp
Fasta Format > whvs1b20
cccatccgtccgtccgtcccggggagaagaccgccggcggaggagaggag acgcgggcgaggcaagaggagagtcaaatccccatcttgctccccccccc gcgccgccgaccccacccgcggcattctctccggcgtccctcctccggcc agggggaaaagcagcagcaggatggtgctgtgggtcttcgggtatgggtc cctgatctggaaccccggattcgacttcgacgagaagatcctgggattca tcaagggatacaagcgaacgtttaatcttgcttgcattgaccatagaggc acaccacagcatccggccaggacctgcacccttgaatccgaagatgaagc catatgctggggaattgcttattgtgtcaaaggtggtctagaaaaagagc gagaagcaatgcagtacttggagagaagagaatgcgagtatgaccagaag atctctgtggatttctacaaggatggaaattctctggaaccagctgtgac ggatgtattagttttcgtatccactcctgatccagttggcaacaaatact atcttggccctgctgctttggaggatatggcaaggcaaattgctacagcc agtggccctaatggatataatagggactacctgttctcaatggagaaggc actgtccaatataagccatgaanacgactcnatcattgtgcttgcngatg aggtgaggaaggt
Download
page-top