Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728114
Length 610 bp
Fasta Format > whvs1b11
cgctctctctcattggaactgtgccagttggccgtgttgagactggtgtc atcaagcctggtatggttgttacctttggtcccactggtctgacaactga ggtcaagtccgttgagatgcaccatgagtctctcctggaggcgcttcccg gtgacaacgtcggcttcaacgtcaagaatgttgccgtgaaggatctgaag cgtgggtttgttgcatccaactccaaggatgaccctgccaaggaggcagc caacttcacctcccaggtcatcatcatgaaccaccctggtcagattggca acggctatgccccagtgctggactgccacacctcgcacattgctgtcaag tttgctgagctggtgaccaagatcgacaggcgatctggtaaggagctgga ggccctgcccaagttcctcaagaatggtgatgctggcatagtgaagatga ttcccaccaagcccatggttgtggagacctttgctacttaccctcctctt ggtcgttttgctgtccgggacatgangcaaactgtggctgttggtgtcat cannggtgtgganaanaangacccaaccnncnccaangtgaccaangctg ccatcaanaa
Download
page-top