Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728108
Length 456 bp
Fasta Format > whvs1b02
tcgccctccaacccaccgccgccgtcgacatgggtaaggtgcacggatcg ctcgcccgtgccgggaaggtgcgcggccagacgcccaaggtcgcgaagca ggacaagaagaagcagccccgcggccgcgcccacaagaggatccagtaca accgccgcttcgtcaccgccgtcgtcggcttcggcaagaagcgcggcccc aactcctccgagaagtaggcgcgccgcaccgccgagccaagaaaaaggct cttcctttgcgctagttttcctctcgtttgttgttacgcaagattatgat gatggaagagacattactgaagtgttaaagtatgcatgttttgcttagtt gaagaatctgagatattgtggtatgggttcatggcttaaatttgcttgtt gtttgtcgttgcccatgatgtgcaacatatgcgtctagattgttccaaaa aaaaaa
Download
page-top