Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728106
Length 752 bp
Fasta Format > whvs1a22
ctcctcttcactcctaaccagcgagtaacactccaagcagccaatggcgt tctccaagcccctggcggctctcctcctcgccgtggcgctggcagcgact gccatgtccgccgccggtcaggatccccaaaactgcaagccgagccgcaa ggtgacggtgcagaacctgtgcggcaaggacctctacctcggtatcgagc cgctggccaacagcaagctcctctacagccctggcttcctgctccgccac ggcacccacgtgtcgtacgacgtgtgctcgtggacggggcgcgtgaaggt gcaggacgccgtggtgacggagttccacatcgggtacgacggcggggcgt ggtaccaggtgagcaccgcccagtcgcacatgcccatccgtgtctccatc accccccacggccaccccctgaaagaccactgccccaccgccggctgcaa cagcggcggccactgcttcnagcactccgtccccggcggcaagtgccacg gcgtcgacgagatcaagatcgtcttctacaacccctanatccanctgatg ggtgtgtttaataantttgcagctcggtgatcctantcntattgcanctg ctanttanttaatcatctgctccaacnanctattgtcntgtcntgtcntc natttgctgttcaattantangtgcntgntgaatgtgtgactananatgt ttcattgtcntgcaatgaactgcatgtcntcanctctntntcaaaaaaaa aa
Download
page-top