Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728100
Length 583 bp
Fasta Format > whvs1a14
aggnggcntagaagaagctggcgccggttcacggcagaggaatacgangg cggggaagaatcccaaggnggagaagcgggcgccggcgancanggaggcc ggcngcgagggcnagacgangggccggaagaagggcagcaaggccaagaa gggcgtggagacntacnagatctacatcttcaaggtgctcanncaggtgc acccggacgtcggcatctcctccaaggccatgtccatcatgaactccttc atcaacgacatcttcgagaagctcgccggggagtccgccaagctggcgag gtacaacaagaagcccaccatcacgtcccgggagatccagacctccgtcc gcctcgtcctccccggggagctcgccaagcacgccgtctccgagggcacc aaggccgtcaccaagttcacatcatcctaggctggcttcgtcgtcgtcgt ttcatgagttgatggcggcaggcatcgtgtatgtagttggcagtantatg atgttacaacctttgtaanaattgtgctgcttgcttgtgggactgaanaa acagtgatgttgctgtttaaatcaaaaaaaaaa
Download
page-top