Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728098
Length 560 bp
Fasta Format > whvs1a10
tgcgtggcgcgggtgctggtgtgcctggaggaggtcggcgccgnattacg agctggtgcacgttcacctccccgccggcgaccacaagggccccgcgcat ctcgctcgcaccccctttggtcaggtcccggctttccaggacggcgatct catccttttcggtgagagaacctcaaatattctttcagatttctatatat ctcgtatcaacacacaaacacaaggaaaagcctgaaagaacaacatcttt gtgttagcttagctatagactgagcaaattgctctgaaaaataattattc agatttcgttatgtcgtcatcccagaatcgcgtgcgatttcgaggtacgt gctccgcaaaggcgcatccgatcttctaaggcagagaagcctcgccgagg cggcggcggtcgacgcatggctcgacgccgaggcccacaactttgacagg gccatgtcggcgatcaccttccagtgcttcgtcgtacccatgttcatggg cgggatgaccgaccagagggtcgtcgaggagaacctggagaagcttaagg tggccctcgg
Download
page-top