Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728095
Length 462 bp
Fasta Format > whvs1a06
caggtcgtgccagcacctcaacttcagatcgccgggacctatgccagcgc tgcggcgagccacgcagtgccgctgaccgtggcagcgtcggtggcgctct tggtggtgactacgccaactttggcggccgtggcgggggtggttcctcct ttggtaccggctttggtgccggctctgacgtccgcccgggcgactggtac tgcacctgcggggcgcacaacttcgccagccgctccagctgcttcaagtg tgctgccttcaaggaggaagctgccgtcaatggtggcgctggtggctttg atggtgacatgtcacgctcaaggggcttcggcttcggcgctgtcggtggc atgggtggcggcatgggagccggcgcggccggtggtcntgccanccgccc tggctggaantctngcnactggatttgcaccangtctggatgcaacnanc acaacttcncca
Download
page-top