Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728093
Length 534 bp
Fasta Format > whvs1a04
agccgcgttctcctctgtggcacgcaacctttgtcccctctagatataga acaacacgcctcgtccacccatacctctagaagtctagatctaggcctga cccgtagttttctgatcgtgttcgcttcgatctcggggtaagctgagttc ggcgtccatgatttgttcctatcacccgtttgttatctgattctcaggtt tctccttctgatcggcgagttggggcttgcggcgatcttggagcatagac gggaggcaagctggatctgcgcacggaagcttccgatctgaccggctggc gtctcagatctgctgctggtctgatgctaaacggcggatctagatgttcc cggcggtctcggtatgttgcagcggcgggcccggaggggctctctccggc gagtacgtgggatcccgtctgctcctccacctcgtgcgacgacggccgac ggctctttgtgttgataattattcnatgctatgtcnataattattanatc taananatcngaggngacgnaangnaanaanatg
Download
page-top