Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728092
Length 152 bp
Fasta Format > whvs1a03
gtgagtgagagatcagttctcgatttcnattccggttccgctcagagaat tccccaggcgagcgagcgagatggcgaccgccgggaaggtgatcaagtgc aaagccgcggtggcgtgggaggcggggaagccgctgtccatggaggaggt gg
Download
page-top