Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619174
Length 825 bp
Fasta Format > rwhvh19h21
gcgtacgctgatttcctattaagcagccgctctgtcaagagacggtttga caaaaaaggttccagcaagaggtcaaatacttggacctgacatggcatat acggaaggaaaatgtacccatgcttgactcagcatggacagaaggtatat atagatccccaacagactgatggttttcgatcatcatgttaacatagatg tttgtcgtactattgataagccgtagggcggatcgcgtagcatccgcagt ccgccaactggagatcacttccttaagccctccatgatgtacgaaccgta gaggtccatcgagtacttgattgcgttgatggcatcttctgctgggagga aatcattcactgcaacctccttgttttcattcttcttgtagtcttcaaag aagcgacggatttcctgtaggcgatgcgggggaagttcactgatgtctct gaagtgacggtactcaggatcatcagcacagacagctatgatcttgtcat ctttctcaccctgatcaatcataggcataagcccaatagcacgggcacgc aggaagcaaccaggaacaacttgttcctgcatcaggacaaggacatccat cgggtcattatcctcacagagtgtgcgtggaatgaagccatagttgtgtg ggtacacaactgaggagtacagaacacgatcaaccttgataagaccagtt gctttgtccaactcatacttaaccttgctgcctctaggaatctcaaccac acagttgaaaactgcaggggcccctggacctatctccaggtcatgccatg ggtgagcagcaacgtgcttttgaga
Download
page-top