Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ618850
Length 819 bp
Fasta Format > rwhvh18c04
tagatagtgatattacatgataaaacaacaaaaataaaagaaatatatca agccacaagatagcatcaatcaagaaaaatgcgcgggaggaagaaattta gccaagaaacaccgatgactgaaactagtagtggaattcatttgccttct tgaaaaccccagcttgggcagaagcagcaccatcagaggtcacggccacg acgatacagtccttcacctgctgggtggtaaatgggaacttcttgttcac aatggagttgaggtatgcagctgccccctcacgtatcagggcgccaatac catcagttctagtgtttgagagtgcatcatgcatatttcctagcttcttg ccacctatcatactgcatgcagcaccaaatgtcttgccgatgttgccgag ggacccaatagctgcaactatagcatctgggtgattcttccagtagtcgc aggatccaatgaacccatgcttctttggacttgcagggacatcatgggaa ggtgcacttggggtgctcggtgtagtgccataagatggcgtcggtgtagt gccgtaagatggcgtcggtgtagtgccgtaagttggcgtcggtgtaatgc cgtaagttggtgtcggtgtagtgccgtaagatggcgtcggtgtagtgccg taagttggtgtcggtgtcagtgtcgggttgtagcctcctcctgacccatg cgtgggagttggtgagcccccatagtgggtcttctgctcatgcaactctc ccaggctcctgcacgagctcagtgaaacaagcccccaccaagacggcact catcagaagaaccttgcca
Download
page-top