Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ618849
Length 886 bp
Fasta Format > rwhvh18c03
agataggtgatattacatggataaaacaacaaaaataaaagaaatatatc aagccacaagatagcatcaatcaagaaaaatgcgcgggaggaagaaattt agccaagaaacaccgatgactgaaactagtagtggaattcatttgccttc ttgaaaaccccagcttgggcagaagcagcaccatcagaggtcacggccac gacgatacagtccttcacctgctgggtggtaaatgggaacttcttgttca caatggagttgaggtatgcagctgccccctcacgtatcagggcgccaata ccatcagttctagtgtttgagagtgcatcatgcatatttcctagcttctt gccacctatcatactgcatgcagcaccaaatgtcttgccgatgttgccga gggacccaatagctgcaactatagcatctgggtgattcttccagtagtcg caggatccaatgaacccatgcttctttggacttgcagggacatcatggga aggtgcacttggggtgctcggtgtagtgccataagatggcgtcggtgtag tgccgtaagatggcgtcggtgtagtgccgtaagttggcgtcggtgtaatg ccgtaagttggtgtcggtgtagtgccgtaagatggcgtcggtgtagtgcc gtaagttggtgtcggtgtcagtgtcgggttgtagcctcctcctgacccat gcgtgggagttggtgagcccccatantgggtcttctgctcatgcaactct cccangctcctgcacnagctcantgaaacaagccccaccaanacngcact catcanaanaaccttgccacccatattgctctcantgtgtgcanacnggg acanaataancaactgaactgaactggtgcctcntg
Download
page-top