Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ618781
Length 844 bp
Fasta Format > rwhvh17n23
aaccaggntctcataacatccaggtttcaccaaagcttacattaggacag tatgtaaggcacaagacagacaccaccaagggcacgatatgcagcgctaa cagctgaacagctaaaatatacccagtacgaacaatgcccttaacaaaac tcagccaatactaaaaactgcttggtgtctgaaacagtgatttggatatc aattgtggaattacttcttcttgatggcagccttggtcaccttggccccg gttgggtccttcttctcaacgcccttgatgacaccaacagccacagtctg cctcatgtcacggacagcaaaacgaccaanaggagggtaagtggcaaagg tctccacaaccatgggcttggtgggaatcatcttcactatgccagcatca ccattcttgaggaacttgggcagggcctccagctccttaccagaccgcct gtcgatcttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgt ggcagtccagcactggggcgtagccgttgccaatctgaccagggtggttc atgatgatgacctgggaggtgaagttggctgcctccttggcagggtcatc cttggagttggatgcaacaaacccacgcttcagatccttcacggcaacgt tcttgacgttgaagccaacgttgtcaccaggaagcgcctccaggagagac tcatggtgcatctcaacggacttgacctcagttgtcagaccagtgggacc aaaggtaacaaccataccaggcttgatgacaccagtctcaacacggccaa caggcacagttccaatgccaccaatcttgtaaacatcctgtagg
Download
page-top