Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ618712
Length 273 bp
Fasta Format > rwhvh17j22
ctcatatatncacatatgagtagaacgagaagtaaaagcgagaaagcana gctgccgacaantgtgaactaacatggcatgtatatgtgtnacttnaact tgcactttaggccttgccagattcctcgcannctggtggcctganngnaa tgaagctgacgcactgcacctggcgcatgttgtcaaagncgatgacncgg acntaggcgtcngggtactccttcttgacctcctccacctcnttgagcnc ctgcgttgcgtcggtgcacccga
Download
page-top