Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621521
Length 571 bp
Fasta Format > rwhvh9p02
atatctttttatattaacaaaacatgcccagcaatcgcttggatgcgatg cggtacttaggtacaaaggataaaacatcagatattaaattggcatgctt aaaaggtgtaaaggcagctcccgtcgtcactcctcgccgttgggtcgaag ttcttggcagtctggtcggtgcatcctgccggtacaggcaaagtaccttg ctgtgcccctttacctcctcctatgcagcaagagatggtgggtgtgtatg gagaatgttctaaccgtagaaggaaccagtcttcatcgcatcctggttag catcacccagagctgcctggctcatgtaggtgtcagcaagctgcacacgc ttgacattgtcctgctcctggacaagcatgtgcccgtactctagcagctt ctccactgtcatctttggctgctcaaaggtcacgggtccgtcccgcgagt tcaccancctcttgccaatgttctcnataccggnagaggtcacccacttg cgcacctcgtcgtcgtacacccgagcacgcanagcaccnaaaaagtcgat ggattgncctgggaangtgnc
Download
page-top