Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621511
Length 684 bp
Fasta Format > rwhvh9o08
cagcaatcgcttggatgcgatgcggtacttaggtacaaaggataaaacat cagatattaaattggcatgcttaaaaggtgtaaaggcagctcccgtcgtc actcctcgccgttgggtcgaagttcttggcagtctggtcggtgcatcctg ccggtacaggcaaagtaccttgctgtgcccctttacctcctcctatgcag caagagatggtgggtgtgtatggagaatgttctaaccgtagaaggaacca gtcttcatcgcatcctggttagcatcacccagagctgcctggctcatgta ggtgtcagcaagctgcacacgcttgacattgtcctgctcctggacaagca tgtgcccgtactctagcagcttctccactgtcatctttggctgctcaaag gtcacgggtccgtcccgcgagttcaccagcctcttgccaatgttctcgat accggtagaggtcacccacttgcgcacctcgtcgtcgtacacccgagcac gcanagcaccgaaaaagtcgatggattgtcctgggaaggtgtcnacgatc ttgacgacggactcntcgctgacattgtcggtctggaagatacccttgca nacaccgatacngncgtcncgggtgggancccannanaacttctccatac ngccatcncngatcanangggcntacaacnncna
Download
page-top