Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621119
Length 415 bp
Fasta Format > rwhvh8c10
tttttacttagggtggcaaaacacagntatatactctccgtccatctctt ccatcagagctggtctcgacctgtaacaacgacgacacacatggctggct aaggtgccctcaagctgctcaaggcgctactagcactctccctccatagg tagataattagatagatagctcgccgacggatcagtagctgtagttcttg acgaacatgttctcgctggcttccgcggcctcgccgtcgctggtgtactt gccgagctgcgccagggagttggccttggcgcgcagcagcagcgcctcct gcgccgcggccacgttctccggccgcccaccccacgtcttgaggcaggtg ttctggagcgcccgcgcgtaggagaaggacacgtgccacgggttcggngc ctgnttcntcccgtt
Download
page-top