Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ620989
Length 716 bp
Fasta Format > rwhvh7i06
cataagcagaagcagtctccactgaaggaatgaatacagagagtgacaaa tgataagtagttctatttgtctttaccaaataggtatactcaatatcttt ttatattaacaaaacatgcccagcaatcgcttggatgcgatgcggtactt aggtacaaaggataaaacatcagatattaaattggcatgcttaaaaggtg taaaggcagctcccgtcgtcactcctcgccgttgggtcgaagttcttggc agtctggtcggtgcatcctgccggtacaggcaaagtaccttgctgtgccc ctttacctcctcctatgcagcaagagatggtgggtgtgtatggagaatgt tctaaccgtagaaggaaccagtcttcatcgcatcctggttagcatcaccc agagctgcctggctcatgtaggtgtcagcaagctgcacacgcttgacatt gtcctgctcctggacaagcatgtgcccgtactctagcagcttctccactg tcatctttggctgctcaaaggtcacgggtccgtcccgcgagttcaccagc ctcttgccaatgttctcgataccggtagaggtcacccacttgcgcacctc gtcgtcgtacacccgagcacgcacagcaccgaaaaagtcnatggattgtc ctgggaaggtgtccacnatcttgacgacngactcntcnctgacattgccn gnctggnannataccc
Download
page-top